4

I have a file like this which is a two-column tab-separated file.

CTGCAGTTTCCCCAAATGTGGGAAACTTGACTGTATAATTTGTGGCAGTGGTA   a1
GATTTCCCCAAATGTGGGAAACTCACTCGGCAGGCGTTGATA  a2

I want to get an output like this:

>a1
CTGCAGTTTCCCCAAATGTG
GGAAACTTGACTGTATAATT
TGTGGCAGTGGTA
>a2
GATTTCCCCAAATGTGGGAA
ACTCACTCGGCAGGCGTTGA
TA

I was trying to use the fold command inside awk. Is it possible to use another command within awk?

Also, the width of each line I want is 15, so I tried something like this, but it didn't work:

awk -F "\t" '{a=$(fold -w 50 $1);print a,$2}' file.txt 

How can I do this?

2
  • Your example output is neither two column nor is it clear where the TAB would be. Commented Mar 10, 2015 at 18:58
  • I changed it. My input file is 2 column tab separated. I never said out put to be a 2 column. Sorry if it caused a confusion Commented Mar 10, 2015 at 19:01

3 Answers 3

5

Here are a couple of ways:

  1. Perl

    perl -ane '$F[0]=~s/.{15}/$&\n/g; print ">$F[1]\n$F[0]\n"' file 
    
  2. awk

    awk '{i=0; printf ">%s\n",$2;
           while(i<=length($1)){
                printf "%s\n", substr($1,i,15);i+=15
            }}' file
    

If you really want to use fold within awk, you could do

awk '{printf ">%s\n",$2; system("echo " $1 "| fold -w 15 ") }' file

Your attempt failed because $() is a shell thing, not an awk thing. To run system commands from within awk, you need to use system(). Then, in order to pass the value of $1 (the sequence) and not the actual string $1 to the shell (if you do, the shell will try and evaluate it and it will return a blank since $1 is not set), you need to exclude the $1 from the quotes.

So, in this example, I am using

               |-------------------------> closing quotes for the 1st part
               |                    |----> closing quotes for the 2nd part
               v                    v   
system( " echo "  $1  " | fold -w 15")
        - ----    --- - ------------
        |  |       |  |       |----------> the 2nd part
        |  |       |  |------------------> opening quotes for the 2nd part       
        |  |       |---------------------> The awk variable, `$1`, 
        |  |                               outside the quotes.         
        |  |-----------------------------> The 1st part       
        |--------------------------------> opening quotes for the 1st part
11
  • Thanks for the answer, can you explain the answer with fold command?? Commented Mar 10, 2015 at 19:05
  • @user3138373 $() is a shell construct, not awk. To call a system command with awk, you use system(). The quoting is funky to protect $1 from being expanded by the shell. Commented Mar 10, 2015 at 19:08
  • Thanks terdon. Also I tried removing double quotes ; something like this and it gave me error so what are those quotes doing awk '{printf ">%s\n",$2; system(echo "$1" | fold -w 15 ) }'file.txt Commented Mar 10, 2015 at 19:12
  • @user3138373 see updated answer, is that clearer? Commented Mar 10, 2015 at 19:14
  • It's a little unclear; it means echo was in double quotes and "|fold -w 15" in double quotes?? I though $1 is in double quotes. Looking more carefully Commented Mar 10, 2015 at 19:18
4

With python test.py < input and test.py:

import sys
for i in sys.stdin:
     s, ident = i.rstrip().split()
     print '>{0}'.format(ident)
     while s:
          print s[:15]
          s = s[15:]
2
  • Hi Anthon Anything in awk?? I just want to use another command within awk. Thanks for the solution Commented Mar 10, 2015 at 18:58
  • @user3138373 Sorry, I don't think my awk skills will get you anything useful, nor am I sure you can call other commands from awk. Commented Mar 10, 2015 at 19:07
3
awk '{ print ">"$2 ; while (length($1)) { print substr($1,1,15) ; $1=substr($1,16) } }'
2
  • Nice, +1. I recommend using printf though since print ">",$2 will add a space between the > and $2. Commented Mar 10, 2015 at 19:05
  • terdon, removing the comma in print serves as well to achieve that. Commented Mar 10, 2015 at 19:07

You must log in to answer this question.

Start asking to get answers

Find the answer to your question by asking.

Ask question

Explore related questions

See similar questions with these tags.