I came across this BMC Genomics paper: Analysis of intra-genomic GC content homogeneity within prokaryotes
And I implemented some Python functions to make this available as part of a personal project. The functions are these:
import numpy as np
from collections import defaultdict
def get_sequence_chunks(sequence, window, step, as_overlap=False):
"""GC Content in a DNA/RNA sub-sequence length k. In
overlap windows of length k, other wise non overlapping.
Inputs:
sequence - a string representing a DNA sequence.
as_overlap - boolean that represents if overlap is needed.
k - a integer representing the lengths of overlapping bases.
Default is 20.
Outputs:
subseq - a string representing a slice of the sequence with or without
overlapping characters.
"""
# make sequence upper case and getting the length of it
sequence, seq_len = sequence.upper(), len(sequence)
# non overlap sequence length
non_overlap = range(0, seq_len - window + 1, step)
# overlap sequence length
overlap = range(0, seq_len - window + 1)
# overlap is needed
if as_overlap:
# iterates to the overlap region
for i in overlap:
# creates the substring
subseq = sequence[i:i + window]
yield subseq
# if non overlap is choosed
else:
# iterates to the non overlap region
for j in non_overlap:
# creates the sub-string to count the gc_content
subseq = sequence[j:j + window]
yield subseq
def gc_content(seq, percent=True):
"""
Calculate G+C content, return percentage (as float between 0 and 100).
Copes mixed case sequences, and with the ambiguous nucleotide S (G or C)
when counting the G and C content. The percentage is calculated against
the full length.
Inputs:
sequence - a string representing a sequence (DNA/RNA/Protein)
Outputs:
gc - a float number or a percent value representing the gc content of the sequence.
"""
seq_len = len(seq)
gc = sum(seq.count(x) for x in ["G", "C", "g", "c", "S", "s"])
if percent:
try:
return gc * 100.0 / seq_len
except ZeroDivisionError:
return 0.0
else:
return gc / seq_len
def get_gc_content_slide_window(sequence, window, step):
"""
Calculate teh GC (G+C) content along a sequence. Returns a dictionary -like
object mapping the sequence window to the gc value (floats).
Returns 0 for windows without any G/C by handling zero division errors, and
does NOT look at any ambiguous nucleotides.
Inputs:
sequence - a string representing a sequence (DNA/RNA/Protein)
window_size - a integer representing the length of sequence to be analyzed
at each step in the full sequence.
step - a integer representing the length of oerlapping sequence allowed.
Outputs:
gc- a dictionary-like object mapping the window size sequence to it gc values
as floating numbers
"""
gc = defaultdict(float)
for s in get_sequence_chunks(sequence, window, step, as_overlap=False):
gc[s] = gc.get(s, 0.0) + gc_content(s)
return gc
def difference_gc(mean_gc, gc_dict):
"""
Calculates the difference between the mean GC content of window i, and the
mean chromosomal GC content, as Di = GC i − GC
"""
# get the keys and default values in the dictionary
d_i = defaultdict(float, [(k, 0.0) for k in gc_dict.keys()])
# iterate through all keys, gc calculated values for the
# genome chunk
for chunk, gc_cnt in gc_dict.items():
# get the difference between the chromosomal mean and the chunks
dif = gc_cnt - mean_gc
# add the difference to the appropriate chunk
d_i[chunk] = dif
return d_i
def get_chromosomal_gc_variantion(difference_dic):
"""
Calculates the chromosomal GC variation defined as the log-transformed average
of the absolute value of the difference between the mean GC content of each
non-overlapping sliding window i and mean chromosomal GC content.
chromosomal_gc_variantion = log(1/N*sum(|Di|), where N is the maximum number of
non-overlapping window size in bp in a sliding windows.
"""
# get the number of chunks
n = len(difference_dic.keys())
arr = np.array(list(difference_dic.values()))
var = np.log((1/n) * sum(abs(arr)))
return var
I worked with e. coli genome: Escherichia coli strain RM13322 chromosome, complete genome
gc = gc_content(ec, percent=True) = 50.76819424506625
It is similar to found here: Genome Assembly and Annotation report (26286) ~ 50.73.
The slide window gave it non overlapping results like, where ec = escherichia coli genome, 100 size window, and step = 100:
get_gc_content_slide_window(ec, 100, 100)
defaultdict(float,
{'GTTGGCATGCCATGGTGATGTTTGTTAGGAAAGCAAAGATGGCAAAACTGCTGGGGGTTTTGTGGTTGAGTATGCCAATATAATTAATAGATTAAAGAGT': 39.0,
'TAGTTGTGAAGAAAATATGGATAAACAGGACGACGAATGCTTTCACCGATAAGGACAACTTTCCATAACTCAGTAAATATAGTGCAGAGTTCACCCTGTC': 39.0,
'AAACGGTTTCTTTTGCAGGAAAGGAATATGAGTTAAAGGTCATTGATGAAAAAACGCCTATTCTTTTTCAGTGGTTTGAACCTAATCCTGAACGATATAA': 34.0,
'GAAAGATGAGGTTCCAATAGTTAATACTAAGCAGCATCCCTATTTAGATAATGTCACAAATGCGGCAAGGATAGAGAGTGATCGTATGATAGGTATTTTT': 36.0,
'GTTGATGGCGATTTTTCAGTCAACCAAAAGACTGCTTTTTCAAAATTGGAACGAGATTTTGAAAATGTAATGATAATCTATCGGGAAGATGTTGACTTCA': 34.0,
'GTATGTATGACAGAAAACTATCAGATATTTATCATGATATTATATGTGAACAAAGGTTACGAACTGAAGACAAAAGAGATGAATACTTGTTGAATCTGTT': 29.0,...}
The difference function (slide window gc content - gc content all sequence), where ec_gc = gc content of e.coli genome and ec_non = gc content in each subsequence of size 100 non overlapped:
difference_gc(ec_gc, ec_non)
defaultdict(float,
{'GTTGGCATGCCATGGTGATGTTTGTTAGGAAAGCAAAGATGGCAAAACTGCTGGGGGTTTTGTGGTTGAGTATGCCAATATAATTAATAGATTAAAGAGT': -11.768194245066248,
'TAGTTGTGAAGAAAATATGGATAAACAGGACGACGAATGCTTTCACCGATAAGGACAACTTTCCATAACTCAGTAAATATAGTGCAGAGTTCACCCTGTC': -11.768194245066248,
'AAACGGTTTCTTTTGCAGGAAAGGAATATGAGTTAAAGGTCATTGATGAAAAAACGCCTATTCTTTTTCAGTGGTTTGAACCTAATCCTGAACGATATAA': -16.768194245066248,
'GAAAGATGAGGTTCCAATAGTTAATACTAAGCAGCATCCCTATTTAGATAATGTCACAAATGCGGCAAGGATAGAGAGTGATCGTATGATAGGTATTTTT': -14.768194245066248,
'GTTGATGGCGATTTTTCAGTCAACCAAAAGACTGCTTTTTCAAAATTGGAACGAGATTTTGAAAATGTAATGATAATCTATCGGGAAGATGTTGACTTCA': -16.768194245066248,...}
And the (ec_dif = difference on gc content from total sequence and from subsequences):
get_chromosomal_gc_variantion(ec_dif)
1.7809591767493207
My principal concern It is to know if this function get_chromosomal_gc_variantion(ec_dif) was implemented as in the paper above (GCVAR):
As suggested, a toy example:
s="TAGTTGTGAAGAAAATATGGATAAACAGGACGACGAATGCTTTCACCGATAAGGACAACTTTCCATAACTCAGTAAATATAGTGCAGAGTTCACCCTGTC"
seq_gc_non_overllap = get_gc_content_slide_window(s, 20, 20)
seq_gc_non_overllap
defaultdict(float,
{'TAGTTGTGAAGAAAATATGG': 30.0,
'ATAAACAGGACGACGAATGC': 45.0,
'TTTCACCGATAAGGACAACT': 40.0,
'TTCCATAACTCAGTAAATAT': 25.0,
'AGTGCAGAGTTCACCCTGTC': 55.0})
seq_gc_total = gc_content(s, percent=True)
seq_gc_total
39.0
seq_dif_gctot_gc_slidewindow = difference_gc(seq_gc_total, seq_gc_non_overllap)
defaultdict(float,
{'TAGTTGTGAAGAAAATATGG': -9.0,
'ATAAACAGGACGACGAATGC': 6.0,
'TTTCACCGATAAGGACAACT': 1.0,
'TTCCATAACTCAGTAAATAT': -14.0,
'AGTGCAGAGTTCACCCTGTC': 16.0})
chromosome_gc_variation = get_chromosomal_gc_variantion(seq_dif_gctot, gc_slidewindow)
chromosome_gc_variation
2.2192034840549946
Any tip to improve the code would be very welcome, once I only have been working with python for a couple of years and I am not very skilled, and much less with numpy.

ec,ec_gc,ec_non,ec_dif? \$\endgroup\$