4
\$\begingroup\$

(See the next iteration.)

This time I have programmed a simple data structure called \$k\$-mer index. The actual word \$k\$-mer is a synonym of substring of length \$k\$. This data structure is built by scanning (preferably) a genomic string \$T\$ over the alphabet \$A, C, G, T\$, and at each window \$W[i \ldots i + k - 1]\$ it takes the list of indices that is mapped by \$W\$ and add \$i\$ to it.

Example

Consider that \$T = ACACTGCA\$, and \$k = 2\$. Now the index will become:

AC -> [0, 2]
CA -> [1, 6]
CT -> [3]
TG -> [4]
GC -> [5]

Code

io.github.coderodde.dna.kmerindex.DnaKmerIndex.java:

package io.github.coderodde.dna.kmerindex;

import java.util.ArrayList;
import java.util.Collections;
import java.util.List;
import java.util.Map;
import java.util.Objects;
import java.util.TreeMap;

/**
 * This class provides a facility for computing the {@code k}-mer index over a
 * genetic string containing the base nucleotides {@code A, C, G, T}.
 * 
 * @version 1.0.0 (Aug 16, 2025)
 * @since 1.0.0 (Aug 16, 2025)
 */
public class DnaKmerIndex {

    /**
     * The actual {@code k}-mer index data structure.
     */
    private final Map<CharSequence, List<Integer>> kmerIndex = new TreeMap<>();
    
    /**
     * Constructs this {@code k}-mer index.
     * 
     * @param genomicString the genomic string.
     * @param k             the {@code k}-parameter.
     */
    public DnaKmerIndex(String genomicString, int k) {
        check(genomicString, k);
        build(genomicString, k);
    }
    
    /**
     * Returns an unmodifiable list of indices at which the input {@code k}-mer
     * starts.
     * 
     * @param kmer the target {@code k}-mer.
     * @return the index of the {@code kmer}.
     */
    public List<Integer> getIndex(CharSequence kmer) {
        return Collections.unmodifiableList(kmerIndex.get(kmer));
    }
    
    /**
     * Performs the deep copy of this {@code k}-mer index and returns the copy.
     * This method might be useful for custom convertion of the index to a 
     * string.
     * 
     * @return the deep copy of this {@code k}-mer index. 
     */
    public Map<CharSequence, List<Integer>> getCopyState() {
        Map<CharSequence, List<Integer>> copy = new TreeMap<>();
        
        for (Map.Entry<CharSequence, List<Integer>> e : kmerIndex.entrySet()) {
            copy.put(e.getKey(), new ArrayList<>(e.getValue()));
        }
        
        return copy;
    }
    
    /**
     * Builds the actual index structure.
     * 
     * @param genomicString the genomic string.
     * @param k             the {@code k}-parameter.
     */
    private void build(String genomicString, int k) {
        for (int startIndex = 0;
                 startIndex < genomicString.length() - k + 1; 
                 startIndex++) {
            
            CharSequence kmer = genomicString.substring(startIndex, 
                                                        startIndex + k);
            
            if (!kmerIndex.containsKey(kmer)) {
                List<Integer> indices = new ArrayList<>();
                indices.add(startIndex);
                kmerIndex.put(kmer, indices);
            } else {
                kmerIndex.get(kmer).add(startIndex);
            }
        }
    }
    
    /**
     * Checks that the input arguments are valid.
     * 
     * @param genomicString the genomic string from which to build the index.
     * @param k             the length of a {@code k}-mer.
     */
    private static void check(String genomicString, int k) {
        Objects.requireNonNull(genomicString, 
                               "The input genomic string is null");
        
        if (k < 0) {
            String exceptionMessage = String.format("k(%d) < 0", k);
            throw new IllegalArgumentException(exceptionMessage);
        }
        
        if (k > genomicString.length()) {
            String exceptionMessage = 
                    String.format("k(%d) > genomicString.length()(%d)", 
                                  k, 
                                  genomicString.length());
            
            throw new IllegalArgumentException(exceptionMessage);
        }
    }
}

io.github.coderodde.dna.kmerindex.DnaKmerIndexToStringConverter.java:

package io.github.coderodde.dna.kmerindex;

import java.util.List;
import java.util.Map;

/**
 * This class provides a facility for converting the {@code k}-mer index to a 
 * string.
 * 
 * @version 1.0.0 (Aug 16, 2025)
 * @since 1.0.0 (Aug 16, 2025)
 */
public class DnaKmerIndexToStringConverter {
    
    private final DnaKmerIndex kmerIndex;
    
    public DnaKmerIndexToStringConverter(DnaKmerIndex kmerIndex) {
        this.kmerIndex = kmerIndex;
    }
    
    @Override
    public String toString() {
        Map<CharSequence, List<Integer>> m = kmerIndex.getCopyState();
        StringBuilder sb = new StringBuilder();
        
        for (Map.Entry<CharSequence, List<Integer>> e : m.entrySet()) {
            sb.append(e.getKey())
              .append(": ")
              .append(e.getValue())
              .append('\n');
        }
        
        if (!sb.isEmpty()) {
            sb.deleteCharAt(sb.length() - 1);
        }
        
        return sb.toString();
    }
}

io.github.coderodde.dna.kmerindex.RandomGeneticStringProvider.java:

package io.github.coderodde.dna.kmerindex;

import java.util.Random;

/**
 * This class provides a facility for computing a random genetic string.
 * 
 * @version 1.0.0 (Aug 16, 2025)
 * @since 1.0.0 (Aug 16, 2025)
 */
public class RandomGeneticStringProvider {
    
    private static final char[] NUCLEOTIDE_BASES = { 'A', 'C', 'G', 'T' };
    
    /**
     * Generates a random genomic string.
     * 
     * @param length the length of the genomic string.
     * @param random the random number generator.
     * @return a random genomic string.
     */
    public static String generate(int length, Random random) {
        StringBuilder sb = new StringBuilder(length);
        
        for (int i = 0; i < length; ++i) {
            int nucleotideIndex = random.nextInt(NUCLEOTIDE_BASES.length);
            sb.append(NUCLEOTIDE_BASES[nucleotideIndex]);
        }
        
        return sb.toString();
    }
    
    /**
     * Generates a random genomic string.
     * 
     * @param length the length of the genomic string.
     * @return a random genomic string.
     */
    public static String generate(int length) {
        return generate(length, new Random());
    }
    
    /**
     * Generates a random genomic string.
     * 
     * @param length the length of the genomic string.
     * @param seed   the seed for the random number generator.
     * @return a random genomic string.
     */
    public static String generate(int length, long seed) {
        return generate(length, new Random(seed));
    }
}

io.github.coderodde.dna.kmerindex.demo.Demo.java:

package io.github.coderodde.dna.kmerindex.demo;

import io.github.coderodde.dna.kmerindex.DnaKmerIndex;
import io.github.coderodde.dna.kmerindex.DnaKmerIndexToStringConverter;
import io.github.coderodde.dna.kmerindex.RandomGeneticStringProvider;

/**
 * This class provides the demonstration program for the {@code k}-mer index.
 * 
 * @version 1.0.0 (Aug 16, 2025)
 * @since 1.0.0 (Aug 16, 2025)
 */
public final class Demo {
    
    private static final int LENGTH = 30;
    private static final int K = 2;
    
    public static void main(String[] args) {
        long seed = System.currentTimeMillis();
        
        System.out.println("seed = " + seed);
        
        String genomicString = RandomGeneticStringProvider.generate(LENGTH,
                                                                    seed);
        
        System.out.println("Genomic string: " + genomicString);
        
        DnaKmerIndex kmerIndex = new DnaKmerIndex(genomicString, K);
        
        System.out.println(new DnaKmerIndexToStringConverter(kmerIndex));
    }
}

Example output

seed = 1755350850543
Genomic string: CCTCCAAAGTTGTCGCGTTTGAGACGCCAG
AA: [5, 6]
AC: [23]
AG: [7, 21, 28]
CA: [4, 27]
CC: [0, 3, 26]
CG: [13, 15, 24]
CT: [1]
GA: [20, 22]
GC: [14, 25]
GT: [8, 11, 16]
TC: [2, 12]
TG: [10, 19]
TT: [9, 17, 18]

Critique request

As always, I am eager to hear any constructive commentary on my attempt.

\$\endgroup\$

1 Answer 1

4
\$\begingroup\$

I like how direct this is: generate a string, cut into k-mers, and index them. While scanning the code, I spotted a few places where the Java details could be tightened up.

  1. Use Map<String, List<Integer>> and normalize inputs to String. Right now the map is Map<CharSequence, List<Integer>> backed by a TreeMap. That’s a footgun: a TreeMap with natural ordering requires keys to be mutually comparable, but different CharSequence types are not. Also getIndex(CharSequence) may fail if the caller passes a StringBuilder because equals will not match a String key.

Make the storage type concrete and normalize at the edges:


    private final Map<String, List<Integer>> kmerIndex = new TreeMap<>();
    
    public List<Integer> getIndex(CharSequence kmer) {
        var list = kmerIndex.get(kmer.toString());   // normalize
        return list == null ? List.of() : Collections.unmodifiableList(list);
    }

Benefits: no risk of ClassCastException in TreeMap, lookups are predictable, and getIndex never throws NPE.

  1. Validate k and input alphabet up front. check(...) allows k == 0, which produces an empty-string k-mer at every position. That is almost never useful. Also, the index accepts any characters; the generator only produces A/C/G/T, but callers can pass arbitrary strings. Fail fast:

    private static void check(String genomicString, int k) {
        Objects.requireNonNull(genomicString, "genomicString is null");
        if (k < 1) throw new IllegalArgumentException("k must be >= 1");
        if (k > genomicString.length()) throw new IllegalArgumentException("k > length");
        for (int i = 0; i < genomicString.length(); i++) {
            char c = genomicString.charAt(i);
            if ((c|32) != 'a' && (c|32) != 'c' && (c|32) != 'g' && (c|32) != 't')
                throw new IllegalArgumentException("Invalid base at " + i + ": " + c);
        }
    }

This keeps the data structure honest regardless of where the input came from.

  1. Fix the StringBuilder bug and avoid extra copying in the converter. DnaKmerIndexToStringConverter.toString() calls sb.isEmpty(), which is not available on StringBuilder in common LTS JDKs. Use sb.length() > 0. Also, getCopyState() deep-copies the whole map on every toString(). That is unnecessary if you just iterate:

    @Override
    public String toString() {
        var sb = new StringBuilder();
        kmerIndex.forEach((k, v) -> sb.append(k).append(": ").append(v).append('\n'));
        if (sb.length() > 0) sb.setLength(sb.length() - 1);
        return sb.toString();
    }

If you want a stable snapshot, expose an iterator or build the snapshot once at construction time.

  1. Use computeIfAbsent and consider a packed integer key for performance The build loop can be simpler and a bit faster:

    for (int i = 0; i <= genomicString.length() - k; i++) {
        String kmer = genomicString.substring(i, i + k);
        kmerIndex.computeIfAbsent(kmer, __ -> new ArrayList<>()).add(i);
    }

If you care about speed and memory with larger k, consider encoding a k-mer as a packed int or long using 2 bits per base (A=00, C=01, G=10, T=11). Then the map key is a primitive value and you can maintain the current k-mer with a rolling update instead of creating a new String each step. That avoids O(n) string allocations.

  1. Minor nits.
  • Document that the class is not thread-safe.
  • RandomGeneticStringProvider can use SplittableRandom or ThreadLocalRandom for better quality and less contention in parallel code.
  • Consider HashMap unless you intentionally want lexicographic ordering in output. If ordering matters only for printing, sort when rendering rather than paying TreeMap cost during builds.
\$\endgroup\$

You must log in to answer this question.

Start asking to get answers

Find the answer to your question by asking.

Ask question

Explore related questions

See similar questions with these tags.